Hey there! Sign in to join this conversationNew here? Join for free
x Turn on thread page Beta
    Offline

    2
    ReputationRep:
    (Original post by bbadonde2)
    Oh, didn't realise! Those marks are pretty generous for full UMS!
    Yeah generally the boundaries for F215 are pretty good because it's such a hard exam


    Posted from TSR Mobile
    Offline

    17
    ReputationRep:
    (Original post by EmmaDalby97)
    I just hate all of the ecosystems module in F215, I don't find it interesting in the slightest so I find it so hard to revise
    SAME!! That has to be the driest module ever.
    Offline

    2
    ReputationRep:
    (Original post by bakedbeans247)
    SAME!! That has to be the driest module ever.
    It's just so so awful, it's easier than all the gene technology stuff but I find it the hardest to revise because I just don't want to do it!!


    Posted from TSR Mobile
    Offline

    2
    ReputationRep:
    Can someone outline the sliding filament model please?
    Offline

    2
    ReputationRep:
    Does anyone know a paper that has done a long answered question with QWC on 'fight or flight' response??

    I saw a question in January 2012 paper but its a grid you have to full in. I want to see how they would mark the answer on a long question as I am currently doing notes and would like to revise using that instead... Thank you
    Offline

    1
    ReputationRep:
    (Original post by YouAgain)
    Does anyone know a paper that has done a long answered question with QWC on 'fight or flight' response??

    I saw a question in January 2012 paper but its a grid you have to full in. I want to see how they would mark the answer on a long question as I am currently doing notes and would like to revise using that instead... Thank you
    Jan 2011 has 9 marker
    Offline

    2
    ReputationRep:
    (Original post by EmmaDalby97)
    Yeah generally the boundaries for F215 are pretty good because it's such a hard exam


    Posted from TSR Mobile
    I've attached a spreadsheet from OCR. Shows the number of students achieving 150 UMS in all series.
    Name:  Screen Shot 2015-06-11 at 17.54.40.png
Views: 216
Size:  16.9 KB
    Offline

    2
    ReputationRep:
    (Original post by gedfed)
    Jan 2011 has 9 marker
    THank you!!


    Few days of revision for f215 :') Are any of you guys ready???
    Offline

    1
    ReputationRep:
    Can someone tell me the most important topics to revise for F215 which I should definitely revise in detail before the exam?
    Offline

    15
    ReputationRep:
    (Original post by ImogenWillis)
    Can someone tell me the most important topics to revise for F215 which I should definitely revise in detail before the exam?
    Honestly, judging by every other OCR science exam so far, all prediction bets are off. Just learn everything the best you can.

    Long answer questions are typically going to be on processes or comparisons (or both - so PCR, in vivo, transcription/translation, etc). Other than that, you can get questions on topics that have different aspects to it - so fight or flight responses, types of behaviour/learning, structuring of the nervous system, quadrats/transects, etc.
    Offline

    2
    ReputationRep:
    (Original post by loperdoper)
    My phone keyboard is crashing every few words, so quote me if nobody replies to you at about 7pm, where I'll be on my laptop and will explain it to you 😊
    Hey just wondering if you'll be able to outline the nitrogen cycle please?
    Offline

    15
    ReputationRep:
    (Original post by Beni24)
    Can someone outline the sliding filament model please?

    The red stuff is myosin, the blue is actin.
    The Z-line signals the end of each sarcomere
    The M-line (not picture) is the middle of the myosin
    The H-band is the section that is only myosin
    The I-band is the section of only actin - it goes across the sarcomeres
    The A-band (not pictured) is the length of myosin

    During contraction, the A-band stays the same length and the M-line remains where it is. Z-lines get closer together, the H-band gets smaller, and the I-band gets smaller as well.

    (Original post by tewas)
    how does automated sequencing differ from electrophoresis, PCR and probes? Thanks
    Electrophoresis seperates out DNA by length, PCR copies sections of DNA, and probes identify DNA pieces in PCR.

    However, automated sequencing is where you have all the pieces of DNA after identifying, copying, and separating out individual fragments. A computer recognises where the DNA pieces overlap, and automatically puts them in sequence.

    So, if you had six sections of DNA that were like
    1) GAGGATAAAA
    2) CCCTAGCGATA
    3) AAATACGCGA
    4) CGATCGATCCC
    5) CTTAGAGT
    6) ATATGCTT

    A computer would recognise that each one has three bases that overlap, and put them in sequence to form
    GAGGATAAAATACGCGATCGATCCCTAGCGATATGCTTAGAGT

    (the order is 134265 btw)
    Offline

    15
    ReputationRep:
    (Original post by Beni24)
    Hey just wondering if you'll be able to outline the nitrogen cycle please?
    Sure!

    So, there's Nitrogen gas in the air, but it's very unreactive and therefore useless. It needs to become something useful.
    It gets into the soil to be useful in a multitude of ways. A lightning strike or the Haber process does this, but this is a minute amount. There are two ways you need to know: ammonification and nitrogen fixation.

    Ammonification is where bacteria/fungi known as decomposers secrete enzymes onto waste material and break it down - this can be animal faeces etc.
    Nitrogen fixation is where a bacteria known as Rhizobium converts the nitrogen gas. Rhizobium lives in nodes (root nodules) on the roots of leguminous plants (peas etc).

    Both of these create ammonium compounds in the soil.
    From then, ammonium compounds are converted to nitrites by a bacteria known as Nitrosomonas
    The nitrites are then converted to nitrates by Nitrobacter.
    The nitrates can then be used by plants.

    In anaerobic conditions (like waterlogged soil), denitrifying bacteria converts the nitrates in the soil back to nitrogen gas, recycling it.

    You need to be able to name Rhizobium, Nitrosomonas, and Nitrobacter by name, but you don't need to know any specific denitrifying bacteria name.
    Offline

    4
    ReputationRep:
    Is it the cerebellum that coordinates muscular movements?
    Offline

    0
    ReputationRep:
    Hey guys, could somebody tell me the differences between reproductive and non-reproductive cloning please?
    Offline

    2
    ReputationRep:
    Does anyone have any good notes on homeobox genes/past paper questions on it

    Is there any point trying to specifically learn the fly example given in the book?:/
    Offline

    13
    ReputationRep:
    (Original post by utsav12)
    Hey guys, could somebody tell me the differences between reproductive and non-reproductive cloning please?
    reproductive is where you allow the cells to differentiate into a blastocyst/zygote or whatever and insert it into the surrogate mother.

    Non reproductive is where you harvest the stem cells after the cell has divided enough
    Offline

    1
    ReputationRep:
    I'm not sure if this has been posted, but I'm finding these videos really useful. He's got more good ones on his channel too. I'd definitely recommend checking them out if you're bored of the book!

    https://www.youtube.com/watch?v=7rqMzPlw79g
    Offline

    1
    ReputationRep:
    By my working i need 149UMS out of 150 for an A*
    Offline

    2
    ReputationRep:
    How does apoptosis work
 
 
 
Reply
Submit reply
Turn on thread page Beta
Updated: June 3, 2016
Poll
Do you agree with the proposed ban on plastic straws and cotton buds?

The Student Room, Get Revising and Marked by Teachers are trading names of The Student Room Group Ltd.

Register Number: 04666380 (England and Wales), VAT No. 806 8067 22 Registered Office: International House, Queens Road, Brighton, BN1 3XE

Write a reply...
Reply
Hide
Reputation gems: You get these gems as you gain rep from other members for making good contributions and giving helpful advice.