The Official PuzzleDonkey Thread Watch

This discussion is closed.
Twhorne
Badges: 0
#541
Report 15 years ago
#541
oKAY..PD1 Round 2 Puzzle 16 WHY TAXI?

HELP
0
manicmoo
Badges: 0
#542
Report 14 years ago
#542
Hi there,

Can any of you help me with this? I'm on puzzledonkey one, level 4, question 16:

The code of life

atgagagaagctgatacgcatgagtttgccca atggattactcattgtgcacgcgaataa
tatgaaagcacacacgaagctaattcctggga aagaagcacacatgaacgcgagtag


I've worked out the whole DNA connection, deciphered the code and got a statement directing me to the FAQ page for the answer. I'm on the FAQ and I can't find anything! I've searched online for the answer and looked at clues on various forums and am still stuck. If any of you can remember the answer to this, PLEASE help me!

Thanks,

gemxx
0
X
new posts
Back
to top
Latest
My Feed

See more of what you like on
The Student Room

You can personalise what you see on TSR. Tell us a little about yourself to get started.

Personalise

People at uni: do initiations (like heavy drinking) put you off joining sports societies?

Yes (216)
67.92%
No (102)
32.08%

Watched Threads

View All