Hey there! Sign in to join this conversationNew here? Join for free
x Turn on thread page Beta

AQA BIOL5 Biology Unit 5 Exam - 22nd June 2011 watch

  • View Poll Results: Are you resitting this unit?
    YES!
    12.91%
    NO!
    87.09%

    Offline

    11
    ReputationRep:
    (Original post by Flux_Pav)
    yeah!
    for A* 120 right?
    148 unfortunately!
    Offline

    0
    ReputationRep:
    Any ideas of the essay questions going to come up
    Offline

    4
    ReputationRep:
    (Original post by Sparkly-Star)
    An overall A - 480 UMS + a combined 90% from A2 modules is an A*. Dunno about her other modules but it could be possible.
    she'd already had said her A2 modules, Unit 4~80 Unit 6~42

    She needs 270/300 for A*, so far she has 122. Hence she'd need 270-122 = 148.

    In Unit 5, total UMS available is 140. Hence impossible
    Offline

    0
    ReputationRep:
    (Original post by Zozza93)
    Thankyou for taking the time to write this for me! I have one question however..
    You say the repeating sequences, does that mean that introns all have the same sequence, but just their position in everyone's DNA differs? Thanks!
    I'm pretty sure introns can be both random non-coding sequences, or repeating sequences (and probably more variations we don't need to know ) and the repeating sequence can be any number of bases long, if I remember usually 3-5. And that there are lots of different sequences throughout the introns.

    I'm not sure about position, I think position of the repeating sequences are the same, but the length of them are different, hence why you can compare between different people. Seems to make the most sense to me, but could be wrong so best if someone else could clarify .
    Offline

    12
    ReputationRep:
    (Original post by Tericon)
    Its always double the number of strands, so theres two strands in 1, so cycle 1 = 4, cycle 2 = 8, cycle 3 = 16, cycle 4 = 32, cycle 5 = 64, cycle 6 = 128.

    My maths is a bit rusty, but I think thats square numbers....
    1 multiplied by 1 does not give 4.

    Get the WD-40 out.
    Offline

    0
    ReputationRep:
    (Original post by Tericon)
    Can you work out my UMS needed please too?

    I got 240 at AS (but have resat Unit 1...) 72/100 Unit 1 116/140 Unit 2 52/60 Unit 3

    A2: Resat unit four again, but first time round I got 74/100

    I reckon I'll have gained at least 10 UMS for unit 1, so that'll make it 82/100 ums for unit 1, and possibly 5 on unit 4 = 79/100.

    So forgetting Unit 6, whats the max I need in this exam for an A overall?

    (Could you calculate pre resits too as well as my resit estimates, just so i know the best and worst case scenairo)

    Thank you
    pre resit you need 166/200 UMS for an A from practical + Unit 5
    best case - 155/200 UMS for an A from prac and Unit 5

    Offline

    0
    ReputationRep:
    (Original post by HSG1992)
    1 multiplied by 1 does not give 4.

    Get the WD-40 out.
    .......no, but 2 x 2 does, theres two strands in each piece of DNA, it is double the number of strands each time.

    so cycle 1 has two strands of DNA, so it is 2 x 2 = 4, cycle 2 = 4 x 2 = 8

    My maths is not that rusty
    Offline

    0
    ReputationRep:
    (Original post by HSG1992)
    1 multiplied by 1 does not give 4.

    Get the WD-40 out.
    Read their post again.. They said that because it has 2 strands, it would be 4.. thats because 2 x 2 = 4
    Offline

    0
    ReputationRep:
    (Original post by NRican)
    pre resit you need 166/200 UMS for an A from practical + Unit 5
    best case - 155/200 UMS for an A from prac and Unit 5

    Thank you very much
    Offline

    0
    ReputationRep:
    after retakes i think im on Low A in bio 1, High B in bio 2 and A in bio 3

    B in bio 4 and A*in bio 6 any rough ideas wat i need in bio 5 for A grade

    much appreicated!!! Reps guna be given
    Offline

    0
    ReputationRep:
    (Original post by kingsmod1)
    after retakes i think im on Low A in bio 1, High B in bio 2 and A in bio 3

    B in bio 4 and A*in bio 6 any rough ideas wat i need in bio 5 for A grade

    much appreicated!!! Reps guna be given
    To calculate that accurately we'd need your UMS scores
    Offline

    13
    ReputationRep:
    I made some notes on the genetic techniques bit - feel free to correct me if I'm wrong..

    Spoiler:
    Show
    Gel Electrophoresis
    1.DNA samples are placed in a well at one end of the gel plate near the negative electrode
    2.DNA is negatively charged - hence the restriction fragments migrate through the pores in the gel towards the positive electrode
    3.The larger the DNA fragment the slower it moves - so the smaller the fragment; the further up the plate it has moved
    4.Current turned off
    5.DNA fragments made visible (i.e. ethidium bromide)

    Sanger/DNA Sequencing
    1.Label the test tubes A, T, C and G
    2.Into each tube add a sample of the DNA to be sequenced, a mixture of the four nucleotides, DNA polymerase and a labelled primer (radiocative or dye)
    3. Add a small amount of modified dideoxynucleotides (nucleotides that do not form a phosphodiester bond - hence don't attach to the next base in sequence) the terminator molecules/dideoxynucleotides are specific to one particular base so place the A* in tube A, T* in T etc...
    4. Allow DNA synthesis to occur
    5. Whether the terminator base T* or the regular nucleotide T joined is random - so the tubes will contain multiple different fragments - with the overwhelming majoirty ending with T (this is using T tube as an example)

    Original = AACGTGATCTGAATGCGGCAGCTAG

    Different strands from this
    AACGT
    AACGTGA
    AACGTGATCTGAA

    ETC......

    6. Seperate the strands using gel electrophoresis

    PCR
    This is effectively DNA replication within a test tube - with the aim of synthsysing a target gene

    1.Add the DNA sample, nucleotides and DNA polymerase to the thermocycler
    2.Heat to around 95 degrees celsius for about two minutes so as to break the hydrogen bonds between strands
    3.Add the primers and cool to around 45-65 and the primers anneal to it's complementary sequence on the two strands
    4.Taq polymerase then synthesyses the comp. DNA strand from the primer
    5.Temperature raised to 95 again and steps 3-4 occur again

    The % of target gene increases as the cycle continues

    Southern Blot

    A method of detecting a specific base sequence in DNA samples - it involves the transfer of electrophoresis seperated DNA fragments to a filter membrane and subsequent fragment detection by probe hybridisation

    1. DNA fragments from electrophoresis gel are made visible (i.e. ethidium bromide)
    2. Place a membrane (i.e. a nylon filter) on the gel and cover with paper towels - then place a weight on top of this
    3. Place membrane in a plastic bag that contains a solution of labelled probes - the probes anneal via cbp to the DNA fragments in the bad with a cbs
    4. If the probe was radiocative then cover nylon membrane with an x-ray film - after development the probe proteins are visible/if fluorescent probe then UV. This will show how much of the DNA fragments are complementary to the DNa probe - hence identifying genes

    Genetic Fingerprinting

    Differences in DNA (i.e. between humans) can be found in non-coding DNA (introns) called satellite DNA - this consists of DNA with tandem repeats (e.g. ATATATATAT) and is either microsatellite (less than 10 base pairs) or minisatellite (10-60 tandem repeats)

    1. Obtain DNA sample
    2. Use PCR to obtain multiple copies of the DNA that contain tandem repeats - the length of the fragment is dependant upon the number of repeats
    3. Fragments are seperated by gel electrophoresis on the basis of size
    4. Transferred to membrane (southern blot)
    5. Probes (UV/Radioactive) are added
    6. Exposed to x-ray/UV

    Vectors

    A vector is a DNA molecule used to transfer foreign genetic material into another cell

    1.Plasmid is cut open using a restriction enzyme
    2.Foreign DNA is cut up with the same enzyme
    3.The genes and plasmids are mixed in a test tube
    4.Because they were cut with the same restriction enzyme some of the genes and plasmids anneal because of comp. sticky ends - forming recombinants - not all will form recombinants and some plasmids will reanneal without incorporating the gene. The process is catalysed by DNA ligase

    It can be used to inactivate genes by cleaving in the middle of a gene on the plasmid and then adding a gene with comp. sticky ends into the middle of the plasmid gene
    Offline

    0
    ReputationRep:
    (Original post by kingsmod1)
    after retakes i think im on Low A in bio 1, High B in bio 2 and A in bio 3

    B in bio 4 and A*in bio 6 any rough ideas wat i need in bio 5 for A grade

    much appreicated!!! Reps guna be given
    around 120 UMS
    • Thread Starter
    Offline

    3
    ReputationRep:
    I'm going to revise DNA tech in a bit, one of the worst chapters.
    Offline

    0
    ReputationRep:
    How are people revising for the essay part? Ive gone through some AS and unit 4 stuff but dont know what else to do :/ ???

    Thanks
    Offline

    0
    ReputationRep:
    do we have to know about control of water potential e.g ADH?
    Offline

    0
    ReputationRep:
    Anyone help me answer Q4cii here http://live.kerboodle.com/NT3/NTLS_R...est_launch.pdf
    Offline

    0
    ReputationRep:
    (Original post by Sparkly-Star)
    *Try to include something relevant outside the spec. I heard this is the way to get that extra edge
    :
    Hello

    I don't suppose you could recommend how much out of spec stuff would be enough to impress the examiner? And also, is it enough to say e.g. 'i recently read an article in which it mentions GM of mosquitos to reduce maleria' or do they want more?
    And also, can i say 'i recently read an article' or do i have to always speak in third person like in an english essay?
    Offline

    13
    ReputationRep:
    (Original post by nrican)
    anyone help me answer q4cii here http://live.kerboodle.com/nt3/ntls_r...est_launch.pdf
    t g g t c
    Offline

    13
    ReputationRep:
    (Original post by Sparkly-Star)
    I'm going to revise DNA tech in a bit, one of the worst chapters.
    I hate that chapter so much.
 
 
 
Reply
Submit reply
Turn on thread page Beta
Updated: June 22, 2016
Poll
Do you like carrot cake?

The Student Room, Get Revising and Marked by Teachers are trading names of The Student Room Group Ltd.

Register Number: 04666380 (England and Wales), VAT No. 806 8067 22 Registered Office: International House, Queens Road, Brighton, BN1 3XE

Write a reply...
Reply
Hide
Reputation gems: You get these gems as you gain rep from other members for making good contributions and giving helpful advice.