girlslovebarbie
Badges: 0
Rep:
?
#1
Report Thread starter 7 years ago
#1
use the first start codon ATG in the DNA sequence as your starting point, what are the 5 amino acids would you expect to see from the 5 following codons?


GCATGGTAAGCATTAGGATTACAGATTTAGGAGGGAAATTGACAGGATATAGATCCCAGATAGGG

this confuses me because when looking at a table theyre is AUG and GUU for the aminos

someone help me understand ?
0
reply
Hype en Ecosse
  • Study Helper
Badges: 20
Rep:
?
#2
Report 7 years ago
#2
(Original post by girlslovebarbie)
use the first start codon ATG in the DNA sequence as your starting point, what are the 5 amino acids would you expect to see from the 5 following codons?


GCATGGTAAGCATTAGGATTACAGATTTAGGAGGGAAATTGACAGGATATAGATCCCAGATAGGG

this confuses me because when looking at a table theyre is AUG and GUU for the aminos

someone help me understand ?
Well, you're looking at a DNA sequence. DNA doesn't have uracil, and most genetics tables show amino acids in terms of the mRNA codons.

So the 5 following amino acids would be from GTA - AGC - ATT - AGG; transcribe that to RNA to find your AA on the table.
0
reply
X

Quick Reply

Attached files
Write a reply...
Reply
new posts
Back
to top
Latest
My Feed

See more of what you like on
The Student Room

You can personalise what you see on TSR. Tell us a little about yourself to get started.

Personalise

What support do you need with your UCAS application?

I need help researching unis (21)
14.69%
I need help researching courses (8)
5.59%
I need help with filling out the application form (7)
4.9%
I need help with my personal statement (58)
40.56%
I need help with understanding how to make my application stand out (36)
25.17%
I need help with something else (let us know in the thread!) (3)
2.1%
I'm feeling confident about my application and don't need any help at the moment (10)
6.99%

Watched Threads

View All