Genetics

5' GCCGAAGCAGAUGUCACCGUACAAGAGUAAUACAUAAAUCAGUAU 3'

AUG is the start codon (and the first amino acid). UAA is the stop codon, so everything after that isn't translated.

In prokaryotes, DNA polymerase I (DNAPI) is involved in primer excision. DNAPII is for DNA repair. DNAPIII does most of the replication (i.e. adding nucleotides to the 3' end of an existing strand).

In eukaryotes, there are more polymerases. Alpha is thought to be involved in lagging strand synthesis (although I don't think scientists are entirely sure yet). Beta is involved in DNA repair. Gamma works with mitochondrial DNA. Delta is the general DNA synthesis enzyme (the equivalent of DNAPIII in prokaryotes). Epsilon is involved in DNA repair too, mostly UV related damage.

RNA polymerase in prokaryotes (there's only one) synthesises all RNAs.

RNAPI (RNA polymerase I) in eukaryotes makes most of the rRNA. RNAPII is involved in mRNA synthesis. RNAPIII makes some rRNA, tRNAs, sRNAs and other small RNAs.

In terms of mechanism of action, RNA polymerases are all similar to each other, they just have slightly different specificities for different products. Same with DNA polymerases.